Using Molecular Data to Test a Biogeographic Connection of the Macaronesian Genus Bystropogon (Lamiaceae) to the New World: A Case of Conflicting Phylogenies

Bystropogon (Lamiaceae) is endemic to the Macaronesian Islands and represents the best-known example of a putative phytogeographic connection between these islands and the New World. Previous morphological taxonomic studies suggested that this genus is closely related to the western South American Minthostachys. Phylogenetic analyses of nucleotide sequences of the internal transcribed spacers and 5.8S subunit of nuclear ribosomal DNA and the trnL gene and trnL-trnF spacer of the chloroplast genome for 33 of the 72 genera in the Mentheae tribe were performed. Maximum parsimony analysis of the combined data set resulted in 63 most parsimonious trees. The strict consensus tree of this analysis shows with moderate bootstrap support (74%) that Bystropogon is sister to the Old World taxa Acinos, Ziziphora, and Clinopodium vulgare. When analyzed separately, the ITS and trnL/F data sets do not agree as to the sister group to Bystropogon, although none supports a sister relationship with Minthostachys. The cpDNA phylogeny strongly supports a relationship of Bystropogon with a clade of New World mint taxa (90% bootstrap value). Due to the apparent conflict between the chloroplast and nuclear characters observed in the phylogenies, we are not certain of the true biogeographic relationship of Bystropogon. Finally, in all analyses, all of the Mentheae genera sampled in this study form a monophyletic group (100% bootstrap value) and a derived clade of ten New World genera is found. These results contribute to our understanding of generic relationships within the tribe. Bystropogon L’Her. and Cedronella Moench (Lamiaceae, Mentheae) are the only genera of mints that are endemic to the Macaronesian Islands. The former is restricted to the Canary and Madeira archipelagos; the latter contains a single species, Cedronella canariensis, found in the Azores, Canaries, and Madeira. Bystropogon has seven species that have radiated primarily in the pine and laurel forests of Macaronesia (La SernaRamos 1984) and represents the best-known example of a putative biogeographic connection between the Macaronesian and New World floras (Bramwell 1972; Sunding 1979). Several authors have indicated that Minthostachys (Benth.) Spach, a genus restricted to western South America with a predominant Andean distribution, is the closest relative of Bystropogon or is congeneric with it (L’Heritier 1788; Bentham 1834, 1848; Spach 1840; Briquet 1897; Epling 1937; La SernaRamos and Wildpret 1976; Sunding 1979; La SernaRamos 1984). Other New World genera that have been suggested by pollen morphology as closely related to Bystropogon are the Juan Fernandez Island endemic genus Cuminia Colla and the North American Pycnanthemum Michx. (Harley and Heywood 1992). In recent years there have been several molecular phylogenetic studies aiming to elucidate the biogeographical connections of Macaronesian plants (e.g., Böhle et al. 1996; Francisco-Ortega et al. 1997; Carvalho and Culham 1998; Vargas et al. 1999; Helfgott et al. 2000; Percy and Cronk 2002). Most of these studies support a link between the Macaronesian flora and the Mediterranean basin. Examples are Argyranthemum Sch. Bip. (Asteraceae ; Francisco-Ortega et al. 1997), the Bencomia Webb and Berthel. alliance (Rosaceae; Helfgott et al. 2000), and Ixanthus Griseb. (Gentianaceae; Thiv et al. 1999). However, Macaronesian taxa have also been found to have phylogenetic links with distant areas such as East and South Africa (reviewed in Andrus et al. 2004), and East Asia. For instance, the endemic genus Phyllis L. (Rubiaceae) is nested within a clade of East-South African genera (Bremer 1996; Anderson et al. 2001) and the Macaronesian endemic Ilex perado Aiton is nested within a clade of East Asian species (Cuénod et al 2000; Manen et al. 2002). Bystropogon and Cedronella are members of the Nepetoideae, the largest of the eight subfamilies of the Lamiaceae (Cantino et al. 1992). Cantino et al. (1992) recognized four tribes in the Nepetoideae: Elcholtzieae, Lavanduleae, Ocimeae, and Mentheae. The Mentheae is the largest of these, containing approximately 72 genera, including both Bystropogon and Cedronella and such economically important plants as mint (Mentha L.), oregano (Origanum L.), rosemary (Rosmarinus L.), sage (Salvia L.), and thyme (Thymus L.). 2004] 703 TRUSTY ET AL.: BYSTROPOGON AND THE NEW WORLD The use of chloroplast DNA [cpDNA] restriction site analysis and nucleotide sequence data have aided in the recognition and recircumscription of the Lamiaceae and Verbenaceae as two monophyletic assemblages (Olmstead et al. 1992, 1993; Wagstaff and Olmstead 1997; Wagstaff et al. 1998). Molecular data also have proven to be a valuable tool at lower taxonomic levels. Studies below the family level have discovered paraphyletic and/or polyphyletic groupings such as the subfamilies Chloanthoideae and Viticoideae, the Satureja L. complex, and Lamium L. (Wink and Kaufmann 1996; Cantino and Wagstaff 1998; Wagstaff et al. 1998). In all of these analyses, monophyly of subfamily Nepetoideae and tribe Mentheae is well supported (Kaufmann and Wink 1994; Wagstaff et al. 1995). Within tribe Mentheae, Monarda L., Mentha, Nepeta L., and Salvia have been the subject of molecular systematic analyses at the species level (Prather et al. 2002; Walker et al. 2002; Jamzad et al. 2003 ; Bunsawat et al., in mss.). Despite their extraordinary economic importance as perfumes, spices, medicinal drugs and horticultural plants, no molecular phylogenetic analysis of the generic relationships within the Mentheae has yet been published. In this paper we review the literature on the phylogenetic connections of Macaronesian plants with the New World and we also provide the first molecular phylogenetic analysis of Mentheae in order to 1) elucidate the phylogenetic relationships of the endemic Macaronesian genus Bystropogon; 2) test the hypothesized sister relationship of Bystropogon to Minthostachys; and 3) provide insight into the phylogenetic relationships among the genera that comprise the Mentheae. In our study we have followed the Lamiaceae classification of Cantino et al. (1992). For members of the Satureja complex, we followed the taxonomic treatments of Heywood and Richardson (1972) for the Old World species, and Cantino and Wagstaff’s (1998) treatment of the New World species. MATERIALS AND METHODS Plant Material. Details of the plant material, voucher information, and geographical distribution of the taxa sampled in this study are listed in Table 1. In the trnL/F analysis, the ingroup consists of 38 taxa representing Mentheae (31 genera), Ocimeae (three), and Lavanduleae (one) (three of the four tribes of Nepetoideae). Three species of Bystropogon, B. canariensis, B. maderensis, and B. origanifolius, from the two sections currently recognized were included (La Serna -Ramos 1984). The ingroup also included the three putative relatives of Bystropogon: Cuminia, Minthostachys, and Pycnanthemum. The ingroup comprised representatives from the New World (12 taxa) and the Old World (26 taxa). Lamium (Lamioideae) was chosen for the outgroup. In previous studies of both rbcL and ndhF sequences and chloroplast restriction site data, Lamium was near, but excluded from, the Nepetoideae (Kaufman and Wink 1994; Wagstaff et al. 1995, 1998). Forty taxa including 33 of the 72 recognized Mentheae genera were used for the ITS analysis. We were unable to amplify the ITS sequence of Calamintha menthifolia Host but have included ITS sequences for Conradina etonia Kral and McCartney, Glechoma hederacea L., and Melissa officinalis L., which are absent from the trnL/F tree. Hyptis Jacq., Lavandula L., Orthosiphon Benth., and Plectranthus L’Hér. (Lavanduleae and Ocimeae tribes) were chosen as the outgroup for both ITS and combined analyses of the ITS and trnL/F data. This outgroup selection was made based on their basal position in the phylogenetic analysis of the trnL/F data set (see Results). The first 143 and last 59 bp of the ITS sequences of these Ocimeae and Lavanduleae taxa were excluded from analysis due to uncertainty of their alignment. The aligned data matrices are deposited in TreeBase Study accession (S1116, matrix accession M1909-1911). DNA Extraction, PCR amplification, and Sequencing. DNA was extracted from either fresh or silica-gel dried material using the Qiagen DNeasy protocol (Qiagen, Ltd.). Both strands of the nuclear ribosomal internal transcribed spacer (ITS) region including the 5.8S gene were amplified using primers ITS4 (White et al. 1990) and ITS5 (Downie and Katz-Downie 1996). The ITS region of Melissa officinalis was amplified using primers 17SE and 26SE (Sun et al. 1994). PCR amplification conditions are described in Kim and Jansen (1994). Difficulty in amplifying the ITS1 region of Clinopodium vulgare resulted in an incomplete sequence that is missing the first 240 aligned bp. The chloroplast trnL gene and trnL-trnF intergenic spacer (trnL/ F) were amplified using the ‘C’ and ‘F’ primers according to the protocol described by Taberlet et al. (1991). Amplification of the trnL-trnF region of Ziziphora hispanica L. was performed with the ‘C’ primer (forward direction) and an internal primer designed for this study (primer JT3R, 59 CGACCATTTCCAAATGATAGCAT 39). Amplification with the regular trnL/F ‘C’ and ‘F’ primers for Z. hispanica yielded multiple bands. PCR products were cleaned using the QIAquick silica columns (Qiagen, Ltd.) according to the manufacturer’s protocol. The purified PCR products were cyclesequenced in both directions using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) with AmpliTaq DNA polymerase. The sequencing reactions were conducted using the same primers that were used for the PCR amplifications. Dye-terminator reactions were carried out in 10 mL reactions, diluted 50:50 using AmpliTaq FS buffer (Applied Biosystems) and amplified according to the manufacturer’s protocol. Cycle sequencing products were separated on an ABI 377 automated sequencer at the Florida International University Sequencing Center. Data Analysis. Sequences were assembled and edited using Sequencher 3.2 (Gene Codes Inc.) and aligned using Clustal X (Thompson et al. 1997). The final alignment was adjusted manually using Se-Al vers. 1 (A. Rambaut, University of Oxford, Oxford, United Kingdom). Regions of high sequence divergence where alignment was ambiguous and those containing long mononucleotide sequences were excluded from subsequent phylogenetic analyses (less than 3% of total number of characters). Less than 0.1% of data matrix cells were scored as missing. Gaps were coded as binary characters according to the ‘‘simple indel coding’’ methodology of Simmons and Ochoterena (2000). Phylogenetic parsimony analyses were performed with Fitch parsimony (equal weights, unordered; Fitch 1971). Initial heuristic searches (using the TBR and MULPARS options of PAUP*) with 1000 random taxon addition replicates were performed to look for multiple optimal tree islands (Maddison 1991). In order to minimize the time searching on sub-optimal islands only 10 trees were saved from each replicate. All trees from the original search were used as starting trees in a second heuristic search with the same search and weighting criteria indicated above until a maximum of 10,000 trees were swapped. Phylogenetic support for each clade was evaluated through bootstrap analysis (Felsenstein 1985) of 1000 replicates with one random sequence addition per replicate and the TBR and MULPARS options (DeBry and Olmstead 2000). In the trnL/F bootstrap analysis, the protocol was modified to save only 20 trees per replicate due to computer memory limitations. Constraint analyses were performed for all three data sets with the three Bystropogon species constrained to be monophyletic with 704 [Volume 29 SYSTEMATIC BOTANY TABLE 1. List of plant material used in this study, with the geographical distribution of the genus (in parentheses), voucher information (botanical institutes where vouchers are deposited in parentheses), and Genbank accession numbers. Acinos alpinus (L.) Moench. (Mediterranean) Ex hort. Orotava Bot. Gard., living accession 195-00, Santos-Guerra 20-6-2000 (ORT); ITS AY227141, trnL/F AY506594. Agastache foeniculum (Pursh) Kuntze (New World and Eastern Asia) Ex hort. Fairchild Tropical Gard., Trusty 29 (FTG); ITS AY506660, trnL/F AY506626. Blephilia hirsuta (Pursh) Benth. (North America) Ex hort. Univ. of Colorado, no voucher; ITS AY506641, trnL/F AY506605. Bystropogon canariensis (L.) L’ Her. (Canary Islands and Madeira) Pedro Alvarez, Tenerife, Santos-Guerra 7-6-1999 (ORT); ITS AY506634, trnL/F AY506597. Bystropogon maderensis Webb (Canary Islands and Madeira) Ribeiro Frio, Madeira, Fontinha and Roberto s. n. (MADJ); ITS AY506633, trnL/F AY506596. Bystropogon origanifolius L’ Her. (Canary Islands and Madeira) Mta. Poleos, Tenerife, Santos-Guerra 8-6-1999 (ORT); ITS AY506635, trnL/F AY506598. Calamintha menthifolia Host (Old World) Las Vueltas, La Palma, Santos-Guerra 12-2-2000 (ORT); ITS N. A., trnL/F AY506609. Cedronella canariensis (L.) Webb and Berth. (Canary Islands) Ex hort. Univ. of Ohio, Cantino 1295 (BHO); ITS AY506656, trnL/F AY506622. Clinopodium ashei (Weath.) Small (New and Old World) Lake Placid, Florida, Trusty 20 (FTG); ITS AY506643, trnL/F AY506607. Clinopodium vulgare L. (New and Old World) Ex hort. Orotava Bot. Gard., living accession 21200, Santos-Guerra 28-8-2000 (ORT); ITS AY506636, trnL/F AY506593. Conradina etonia Kral and McCartney (Southeastern United States) Volusa County, Florida, J. A. Churchill 91-200 (MSC); ITS AF369165, trnL/F N. A.. Cuminia fernandezia Colla (Juan Fernandez Islands, Chile) Masatierra, Juan Fernandez Islands, Stuessy and Soto 11914 (CONC); ITS AY506636, trnL/F AY506599. Dicerandra frutescens Shinners (Southeastern United States) Lake Placid, Florida, Trusty 22 (FTG); ITS AY506642, trnL/F AY506606. Dracocephalum moldavica L. (Eurasia) Ex hort. Fairchild Tropical Gard., Trusty 18 (FTG); ITS AY506659, trnL/F AY506625. Glechoma hederacea L. (Eurasia) Ex hort. Cornell Univ., no voucher; ITS AY506661, trnL/F N. A.. Hesperozygis spathulata Epling (Mexico to Brazil) Paraná; Serrinha, Brazil, Dusen 15165 (MSC); ITS AF369162, trnL/F AY506602. Horminum pyrenaicum L. (Southern Europe) Ex hort. Fairchild Tropical Gard., Trusty 28 (FTG); ITS AY506654, trnL/F AY506620. Hyptis emoryi Torr. (New World) Ex hort. Rancho Santa Ana Bot. Gard. living accession 11020, Olmstead 92-285 (WTU); ITS AY506664, trnL/F AY506629. Hyssopus seravschanicus (Dub.) Pazij (Eurasia) Royal Bot. Gard., Edinburgh, living accession 19840408, no voucher; ITS AY506657, trnL/F AY506623. Lallemantia peltata (L.) Fisch. and C.A. Mey. (Asia) Ex hort. Orotava Bot. Gard., living accession 199-00, Santos-Guerra 20-6-2000 (ORT); ITS AY506658, trnL/F AY506624. Lamium amplexicaule L. (Africa and Eurasia) Callejones, La Palma, Santos-Guerra 13-2-2000 (ORT); ITS N. A., trnL/F AY506631. Lavandula multifida L. (Atlantic Islands, Africa, India, Eurasia) Ex hort. Univ. of Colorado, Wagstaff 92-88 (WTU); ITS AY506665, trnL/F AY506630. Lycopus europaeus var. exaltatus (L. f.) Hook. f. (North America and Northern Europe) Ex hort. Fairchild Tropical Gard., Trusty 26 (FTG); ITS AY506652, trnL/F AY506618. Melissa officinalis L. (Eurasia) Ex hort. Fairchild Tropical Gard., Trusty 439 (FTG); ITS AY506650, trnL/F N. A.. Mentha rotundifolia (L.) Huds. (Temperate Old World) Wagstaff 88-026 (BHO); ITS AY506645, trnL/F AY506610. Micromeria hyssopifolia Webb. and Berthel. (Old World) Chı́o, Tenerife, Canary Islands. Santos-Guerra 17-2-2000. (ORT); ITS AY227142, trnL/F AY506612. Minthostachys mollis (Kunth) Griseb. (Andean South America) Tulcan, Ecuador, Thompson and Rawlins 942 (BHO); ITS AY506638, trnL/F AY506601. Monarda fistulosa L. (North America) Ex hort. Univ. of Colorado, no voucher; ITS AY506639, trnL/F AY506603. Monardella hypoleuca A. Gray (Western North America) Ex hort. Univ. of California, Berkeley Bot. Gard. living accession 65-1096, no voucher; ITS AY506637, trnL/F AY506600. Nepeta grandiflora M. Bieb. (Eurasia and Africa) Ex hort. Fairchild Tropical Gard., Trusty 27 (FTG); ITS AY506655, trnL/F AY506621. Origanum vulgare L. (Eurasia) Las Vueltas, La Palma, Santos-Guerra 12-2-2000 (ORT); ITS AY506647, trnL/F AY506614. Orthosiphon stamineus Benth. (Old World tropical) Ex hort. Fairchild Tropical Gard., living accession 961538, Trusty 23 (FTG); ITS AY506663, trnL/F AY506628. Perovskia abrotanoides Karel (Middle East to India) Ex hort. Orotava Bot. Gard., living accession 200-00, Santos-Guerra 20-62000 (ORT); ITS AY506648, trnL/F AY506615. Piloblephis rigida Raf. (Southeastern United States) Lake Placid, Florida, Trusty 21 (FTG); ITS AY506644, trnL/F AY506608. Plectranthus strigosus Benth. (Old World) Ex hort. Univ. of Colorado, no voucher; ITS AY506662, trnL/F AY506627. Prunella vulgaris L. (Eurasia) Ex hort. Orotava Bot. Gard., living accession 194-00, SantosGuerra 20-6-2000 (ORT); ITS AY506653, trnL/F AY506619. Pycnanthemum incanum (L.) Michx. (North America) Bloomington, Indiana, Olmstead 90-06 (WTU); ITS AY506640, trnL/F AY506604. Rosmarinus officinalis L. (Mediterranean) Ex hort. Royal Bot. Gard, Madrid, living accession 1234-78, Barra 167 (MA); ITS AY506649, trnL/F AY506616. Salvia coccinea Etl. (Worldwide) Ex hort. Fairchild Tropical Gard., living accession 87395, Trusty 24 (FTG); ITS AY506651, trnL/F AY506617. Satureja hortensis L. (Europe) Ex hort. Fairchild Tropical Gard., Trusty 17 (FTG); ITS AY227143, trnL/F AY506611. Thymus vulgaris L. (Eurasia) Ex hort. Royal Bot. Gard., Madrid, living accession 1877-80, Fuertes s. n. (MA); ITS AY506646, trnL/F AY506613. Ziziphora hispanica L. (Mediterranean) Madrid, Spain, Sánchez-Mata and Gavilán 100 (MSC); ITS AF369166, trnL/F AY506595. either the Old World clade that includes Acinos Mill., Ziziphora L., and Clinopodium vulgare, or to the New World assemblage containing the following ten taxa: Blephilia Raf., Cuminia, Dicerandra Benth., Hesperozygis Epling, Minthostachys, Monarda L., Monardella Benth., Piloblephis Raf., Pycnanthemum, and Clinopodium ashei. Search strategies were the same as described above. The incongruence length difference test (ILD) as implemented in PAUP* vers. 4.0b10 (Swofford et al. 2002) was used to test whether the two data sets differ from random partitions of the combined data set in order to explore the congruence of the ITS and trnL/F data sets (Farris et al. 1994). One thousand replicates were run with the following heuristic search strategy: one random sequence addition per replicate, TBR and MULPARS options, keeping a maximum of 10,000 trees per replicate. Finally, the Templeton test as implemented in PAUP* vers. 4.0b10 was used to test whether the strict consensus tree from the ITS data set is significantly different from the strict consensus tree from the trnL/F data set.